4 Transcription de l’adn





télécharger 28.05 Kb.
titre4 Transcription de l’adn
date de publication22.09.2017
taille28.05 Kb.
typeTranscription
TD ADN Radiobiologie et BCM


1
1) Structure de l’ADN http://svt.premiere.s.free.fr/images/1geno/nucleotide.jpg

  • Décoder l’acronyme ADN :


3

2
L’unité de base de l’ADN est figurée sur le document ci-contre :

Donner le nom de cette molécule et légender ce document

Nom : 1= 2= 3=

  • La structure 3 existe sous 4 formes différentes dans l’ADN : les entourer parmi les suivantes :

http://www.snv.jussieu.fr/bmedia/coursbc/ac.nucleiques/an1.gif

  • Structure primaire de l’ADN : enchainement des structures de base par des liaisons phosphodiesters : http://www.snv.jussieu.fr/bmedia/coursbc/ac.nucleiques/an6.gif



  • Structure secondaire de l’ADN : appariement entre les structures 3

http://www.snv.jussieu.fr/bmedia/coursbc/ac.nucleiques/an9.gif

  • Entre T et A il y a ….liaisons ……………………

  • Entre C et G il y en a ………http://upload.wikimedia.org/wikipedia/commons/thumb/f/f5/dna_chemical_structure-1-.fr.svg/512px-dna_chemical_structure-1-.fr.svg.png

Les 2 brins sont antiparallèles 5’-3’

http://adele.nicoweb.com/wp-content/uploads/2012/02/mod_article2703442_21.gif

Puis forme en double hélice

2) Exercice :

  • Identifier les bases présentes dans les structures suivantes :

http://fr.academic.ru/pictures/frwiki/65/adenosine.png http://www.sigmaaldrich.com/medium/structureimages/33/mfcd00071533.png http://www.oncoprof.net/generale2000/g09_chimiotherapie/images/structure5fu.gif http://upload.wikimedia.org/wikipedia/commons/thumb/f/ff/dc_chemical_structure.png/220px-dc_chemical_structure.png http://images.wikia.com/genealogy/images/0/04/tmp_chemical_structure.png

A B C D E

  • Parmi ces bases, lesquelles :

a) contiennent du ribose :

b) contiennent du désoxyribose :

c) contiennent une purine :

d) contiennent une pyrimidine :

e) contiennent de la guanine :

f) sont des nucléosides :

g) sont des nucléotides :

h) se trouvent dans l’ARN :

i) se trouvent dans l’ADN :

3) Réplication de l’ADN

Pour dupliquer l’ADN (recopier à l’identique pour avoir 2 exemplaires avant la mitose) les 2 brins sont séparés et une enzyme vient mettre la base adéquate en face de chaque base.

Ecrire les molécules filles obtenues en dupliquant la portion d’ADN suivante, en observant la règle d’appariement des bases :

AATGCTGGCAATCCTTGGAA

AATGCTGGCAATCCTTGGAA

TTACGACCGTTAGGAACCTT

TTACGACCGTTAGGAACCTT

4) Transcription de l’ADN

Pour que l’information sorte du noyau, elle doit être « transcrite » sous forme d’ARNm, molécule monocaténaire où le T est remplacé par le U (et le sucre est le ribose). Un seul brin d’ADN sert de matrice et est transcrit on le nomme brin non codant.

Ecrire la portion d’ARNm correspondant au fragment du brin codant de l’ADN ci-dessous :

5’ ATACGGGATCCGAGCTCTCGATCGTCTGCAGAAATTCC 3’

5) Traduction

L’ARNm sort du noyau et est pris en charge par les ribosomes qui vont traduire le message en protéine.

Pour cela il existe un code, nommé code génétique.

Caractéristiques du code génétique :

Il faut faire correspondre l’ARNm composé de 4 bases différentes avec une protéine composée de 20 acides aminés différents 

Donc 1 base ne peut pas correspondre à un aa (4<<20 !)

  • Est-ce que 2 bases successives peuvent convenir ? Calculer le nombre de combinaisons différentes de 2 bases parmi 4 :

  • Est-ce que cela suffit pour coder 20 aa ?

Même calcul pour un code à 3 lettres :


Conclusion : Un groupe de ….. bases ou triplet de bases de l'ARN m code pour 1 acide aminé.

Ces 3 bases de ARNm s'appellent codon

Code dégénéré

Le code est dégénéré : 61 codons → 20 acides aminés.

  • 61 codons ayant un sens (qui correspondent chacun à 1 acide aminé), dont 1 codon d'initiation AUG),

  • 3 codons non-sens ou stop ou de terminaison (UAA, UAG, UGA).

Donc plusieurs codons pour le même acide aminé (codons synonymes).

En général les codons synonymes différents par la nature du d'une base (le plus souvent la 3ème).
Exercice 1

calculer le nombre de codons pour chaque acide aminé.(voir tableau code génétique page suivante)


Phe

Ser

Tyr

Asp

Leu

Pro

His

Glu

Ile

Thr

Gln

Cys

Val

Ala

Asn

Arg

Met

Trp

Lys

Gly



Rq : Il n'y a pas de chevauchement entre les triplets, ils sont lus à la suite les uns des autres.

Exercice 2 

L'ocytocine et la vasopressine sont deux hormones fabriquées par l'hypophyse antérieure.

Voici les deux séquences de nucléotides présentes sur le gène codant pour chacune de ces hormones (brin

codant).

Ocytocine : TGC TAC ATC CAG AAC TGC CCC CTG GGC

Vasopressine : TGC TAC TTC CAG AAC TGC CCA AGA GGA

1. Déterminer la séquence peptidique de ces deux hormones.

2. Comparer les brins d'ADN ; compter le nombre de différences.
3. Comparer les séquences des deux hormones protéiques.
4. Conclure.


http://raymond.rodriguez1.free.fr/documents/cellule-genome/codeg.jpg
Exercice 3

Le diabète de type 1 résulte d'un manque d'insuline ; le pancréas ne fabrique pas cette hormone.

Les premier traitements consistaient à injecter aux diabétique de l'insuline de porc, ou d'un autre animal.

Actuellement l'insuline est obtenue par transgénèse : le gène de l'insuline peut être extrait d'une cellule humaine et inséré dans l'ADN d'une bactérie. Cette bactérie produit alors de l'insuline humaine.

Quelle indication cela nous donne-t-il sur le code génétique ?
Exercice 4

Des chercheurs ont réalisé une transgénèse entre une Paramécie et un Lapin. Après avoir isolé les gènes codant pour des protéines membranaires de la Paramécie, ils les ont introduits dans des cellules de Lapin afin que celle-ci synthétisent les protéines de la Paramécie. Ils ont eu la surprise de constater que les cellules de Lapin ne synthétisent jamais la protéine complète.

Pourquoi les chercheurs sont-ils “surpris” ?
Pour élucider ce mystère, ils font l'analyse du gène dont voici un fragment du brin non codant.

TAT TTC TCC ATG CCG CTC ATT CGC GCA CGA

Pourquoi les cellules de Lapin sont-elles incapables de synthétiser la molécule entière ?
Quelle indication cela nous donne-t-il sur le code génétique ?




Exercice 5

La myopathie de Duchenne est une maladie génétique due à un seul gène. Ce gène, situé sur le chromosome X, comporte plus de 2 millions de paires de nucléotides ( c'est un gène bien plus long que la

moyenne). Il permet la synthèse d'une protéine musculaire: la dystrophine. Le fragment du brin d'ADN

codant (= non transcrit) suivant correspond aux acides aminés 109 à 114 de la dystrophine:

... GGT TTG ATT TGG AAT ATA ...

Suite à diverses mutations, la séquence des nucléotides du gène peut changer. La myopathie de Duchenne est due à un de ces changements.

a. Indiquez quels sont les acides aminés 109 à 114 de la dystrophine.

b. Déterminez les conséquences sur la protéine formée si:

- le gène possède un nucléotide A au lieu de T en position 15

- le gène possède un nucléotide A au lieu de G en position 6

- le gène possède un nucléotide A au lieu de G en position 12.
http://healthinfoispower.files.wordpress.com/2011/08/gene-mutation.jpg


Radiobiologie :

Les radiations ionisantes peuvent provoquer indirectement (via radicaux libres) des mutations de l’ADN.

Si ces mutations sont réparées, la cellule survit.

Si ces mutations sont non réparées, la cellule peut soit mourir soit survivre mais transformée, elle peut devenir cancéreuse ou transmettre des anomalies à la descendance si gamète.
http://www.holisticwellbeingcenter.com/radiationcancer.gif


Efficacité relative de différents types de radiations pour produire des mutations chez la drosophile

Type de radiation

% de chromosomes X portant des mutations létales après une irradiation de 1000 röntgens

Lumière visible (spontanée)

0.15

Rayons β, γ , X durs

2,90

Neutrons

1.90

Rayons α

0.84


cliquez pour avoir l\'image cliquez pour voir l\'image cliquez pour voir l\'image

Drosophile normale pattes sur tête ailes supplémentaires


similaire:

4 Transcription de l’adn iconLa transcription de l'adn des Eucaryotes

4 Transcription de l’adn iconVirus de l’Immunodéficience Humaine
«main» qui prend les nucléotides ds la ¢ pr les positionner : 1°/elle transcrit l’arn viral en 1 brin d’adn, puis 2°/ elle copie...

4 Transcription de l’adn iconQuestionnaire Présentation personnelle
«maison» et $332 millions pour les puces préfabriquées (type Affymétrix, Agilent …). Le marché des puces adn comprend les puces adn,...

4 Transcription de l’adn iconTranscription et analyse de corpus multimodaux avec clan
«Transcription et analyse de corpus multimodaux avec le programme clan» est organisé par le groupe de travail multimodalité et nouvelles...

4 Transcription de l’adn iconLe Comité consultatif national d'éthique publie un avis sur les enjeux...
«Jusqu'où a-t-on le droit d'aller ?», traduit le Comité consultatif national d'éthique (ccne), qui présentait vendredi son dernier...

4 Transcription de l’adn iconTranscription de

4 Transcription de l’adn iconSynthèse de l’adn

4 Transcription de l’adn icon5. Transcription inverse 18

4 Transcription de l’adn iconLa transcription inverse

4 Transcription de l’adn iconTranscription inverse





Tous droits réservés. Copyright © 2016
contacts
m.20-bal.com